| Accession | MI0003518 | ||||||
| Name | mmu-mir-540 | ||||||
| similar to following miRCarta precursors | mmu-25195-25194.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr12:109,586,080-109,586,146 (+) |
||||||
| miRNA | mmu-miR-540-5p | ||||||
| miRNA | mmu-miR-540-3p | ||||||
| Sequence (5' -> 3') (67 nts) |
UGGGCCAAGGGUCACCCUCUGACUCUGUGGCCAAGGGUAGACAGGUCAGAGGUCGAUCCUGGGCCUA | ||||||
| MFE | -40.90 kcal/mol | ||||||
| first miRBase version | 8.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (14 precursors) |
mmu-mir-493
mmu-mir-337 mmu-mir-3544 mmu-mir-540 mmu-mir-665 mmu-mir-3070-1 mmu-mir-3070-2 mmu-mir-431 mmu-mir-433 mmu-mir-127 mmu-mir-434 mmu-mir-432 mmu-mir-3071 mmu-mir-136 |
||||||
| Family | mir-540 (MIPF0000212) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Takada et al. | Nucleic Acids Res. | 2006 | 16973894 | Mouse microRNA profiles determined with a new and sensitive cloning method. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |