| Accession | MI0003513 | ||||
| Name | hsa-mir-455 | ||||
| similar to following miRCarta precursors | hsa-232-135.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr9:114,209,434-114,209,529 (+) |
||||
| miRNA | hsa-miR-455-5p | ||||
| miRNA | hsa-miR-455-3p | ||||
| Sequence (5' -> 3') (96 nts) |
UCCCUGGCGUGAGGGUAUGUGCCUUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGCCUAUGUCAUC | ||||
| MFE | -42.10 kcal/mol | ||||
| first miRBase version | 7.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-455 |
||||
| Family | mir-455 (MIPF0000129) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |