Precursor miRBase

hsa-mir-455 (MI0003513)

Accession MI0003513
Name hsa-mir-455
similar to following miRCarta precursors hsa-232-135.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr9:114,209,434-114,209,529 (+)
miRNA hsa-miR-455-5p
miRNA hsa-miR-455-3p
Sequence (5' -> 3')
(96 nts)
UCCCUGGCGUGAGGGUAUGUGCCUUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGCCUAUGUCAUC
MFE -42.10 kcal/mol
first miRBase version 7.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-455
Family mir-455 (MIPF0000129)
Experiments
experiment Pubmed link
cloned 17604727 17616659
External DBs
Gene symbol MIR455
NCBI Gene 619556

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.
2 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.