| Accession | MI0003177 | ||||||
| Name | hsa-mir-522 | ||||||
| similar to following miRCarta precursors | hsa-733-909.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chr19:53,751,211-53,751,297 (+) |
||||||
| miRNA | hsa-miR-522-5p | ||||||
| miRNA | hsa-miR-522-3p | ||||||
| Sequence (5' -> 3') (87 nts) |
UCUCAGGCUGUGUCCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAAUGGUUCCCUUUAGAGUGUUACGCUUUGAGA | ||||||
| MFE | -35.30 kcal/mol | ||||||
| first miRBase version | 7.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (9 precursors) |
hsa-mir-517c
hsa-mir-520h hsa-mir-521-1 hsa-mir-522 hsa-mir-519a-1 hsa-mir-527 hsa-mir-516a-1 hsa-mir-1283-2 hsa-mir-516a-2 |
||||||
| Family | mir-515 (MIPF0000020) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |