Accession | MI0002699 |
Name | ppy-mir-98 |
similar to following miRCarta precursors | ppy-143.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
X:53,953,964-53,954,043 (-) |
miRNA | ppy-miR-98 |
Sequence (5' -> 3') (80 nts) |
GUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUAGGCCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCC |
MFE | -31.50 kcal/mol |
first miRBase version | 7.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
ppy-mir-98 ppy-let-7f-2 |
Family | let-7 (MIPF0000002) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |