Precursor miRBase

ggo-mir-95 (MI0002691)

Accession MI0002691
Name ggo-mir-95
similar to following miRCarta precursors ggo-328.1
Organism Gorilla gorilla
Genome GorGor3
Location 4:8,421,527-8,421,607 (-)
miRNA ggo-miR-95
Sequence (5' -> 3')
(81 nts)
AACACAGUGGGCACUCAAUAAAUGUCUGUUGAAUUGAAAUGCGUUACAUUCAACGGGUAUUUAUUGAGCACCCACUCUGUG
MFE -36.40 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-95
Family mir-95 (MIPF0000098)
External DBs
Gene symbol MIR95
NCBI Gene 102466002

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.