Accession | MI0002610 |
Name | ppy-mir-188 |
similar to following miRCarta precursors | ppy-397.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
X:50,536,260-50,536,345 (+) |
miRNA | ppy-miR-188 |
Sequence (5' -> 3') (86 nts) |
UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACCCCUCCCACAUGCAGGGUUUGCAGGAUGGCGAGCC |
MFE | -38.40 kcal/mol |
first miRBase version | 7.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (4 precursors) |
ppy-mir-532
ppy-mir-188 ppy-mir-500 ppy-mir-362 |
Family | mir-188 (MIPF0000113) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |