Accession | MI0002598 | ||||
Name | ggo-mir-154 | ||||
similar to following miRCarta precursors | ggo-439.1 | ||||
Organism | Gorilla gorilla | ||||
Genome | GorGor3 | ||||
Location |
14:83,037,628-83,037,711 (+) |
||||
miRNA | ggo-miR-154 | ||||
Sequence (5' -> 3') (84 nts) |
GUGGUACUUGAAGAUAGGUUAUCCGUGUUGCCUUCGCUUUAUUUGUGACGAAUCAUACACGGUUGACCUAUUUUUCAGUACCAA | ||||
MFE | -36.80 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (11 precursors) |
ggo-mir-487a
ggo-mir-134 ggo-mir-668 ggo-mir-485 ggo-mir-323b ggo-mir-154 ggo-mir-496 ggo-mir-377 ggo-mir-409 ggo-mir-410 ggo-mir-656 |
||||
Family | mir-154 (MIPF0000018) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |