Accession | MI0002532 | ||||
Name | ptr-mir-133a-1 | ||||
similar to following miRCarta precursors | ptr-320.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
18:17,494,683-17,494,770 (-) |
||||
miRNA | ptr-miR-133a | ||||
Sequence (5' -> 3') (88 nts) |
ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA | ||||
MFE | -40.70 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
ptr-mir-133a-1 ptr-mir-1-2 |
||||
Family | mir-133 (MIPF0000029) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |