Accession | MI0002525 | ||||
Name | ggo-mir-130a | ||||
similar to following miRCarta precursors | ggo-139.1 | ||||
Organism | Gorilla gorilla | ||||
Genome | GorGor3 | ||||
Location |
11:54,359,557-54,359,645 (+) |
||||
miRNA | ggo-miR-130a | ||||
Sequence (5' -> 3') (89 nts) |
UGCUGCUGGCCAGAGCUCUUUUCACAUUGUGCUACUGUCUGCACCUGUCACUAGCAGUGCAAUGUUAAAAGGGCAUUGGCCGUGUAGUG | ||||
MFE | -42.20 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
ggo-mir-130a |
||||
Family | mir-130 (MIPF0000034) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |