Precursor miRBase

dre-mir-29b-3 (MI0001936)

Accession MI0001936
Name dre-mir-29b-3
potential naming conflicts with dre-mir-29b-3 (MI0001935)
entry is obsolete
MI0001936 -> MI0001934
Three annotated mir-29b loci collapse to two in the Zv9 assembly.
Organism Danio rerio
Sequence (5' -> 3')
(88 nts)
UCUUCCUCCAGAUGCUGGUUUCACAUGGUGGUUUAGAUGUGUUCUACCAAAGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGAGGG
MFE -38.50 kcal/mol
first miRBase version 7.0
last miRBase version 17.0
Experiments
experiment Pubmed link
cloned 15937218

Predicted Structure