| Accession | MI0001733 | ||||||
| Name | hsa-mir-452 | ||||||
| similar to following miRCarta precursors | hsa-188-457.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chrX:151,959,628-151,959,712 (-) |
||||||
| miRNA | hsa-miR-452-5p | ||||||
| miRNA | hsa-miR-452-3p | ||||||
| Sequence (5' -> 3') (85 nts) |
GCUAAGCACUUACAACUGUUUGCAGAGGAAACUGAGACUUUGUAACUAUGUCUCAGUCUCAUCUGCAAAGAAGUAAGUGCUUUGC | ||||||
| MFE | -40.40 kcal/mol | ||||||
| first miRBase version | 7.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-224
hsa-mir-452 |
||||||
| Family | mir-452 (MIPF0000287) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 3 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |