Accession | MI0001729 | ||||
Name | hsa-mir-451a | ||||
similar to following miRCarta precursors | hsa-83.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr17:28,861,369-28,861,440 (-) |
||||
miRNA | hsa-miR-451a | ||||
Sequence (5' -> 3') (72 nts) |
CUUGGGAAUGGCAAGGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAUGGUUCUCUUGCUAUACCCAGA | ||||
MFE | -43.40 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (4 precursors) |
hsa-mir-451a hsa-mir-451b hsa-mir-144 hsa-mir-4732 |
||||
Family | mir-451 (MIPF0000148) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
2 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |