| Accession | MI0001726 | ||||
| Name | hsa-mir-329-2 | ||||
| similar to following miRCarta precursors | hsa-1247-586.2 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr14:101,027,100-101,027,183 (+) |
||||
| miRNA | hsa-miR-329-5p | ||||
| miRNA | hsa-miR-329-3p | ||||
| Sequence (5' -> 3') (84 nts) |
GUGGUACCUGAAGAGAGGUUUUCUGGGUUUCUGUUUCUUUAUUGAGGACGAAACACACCUGGUUAACCUCUUUUCCAGUAUCAA | ||||
| MFE | -35.00 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (13 precursors) |
hsa-mir-379
hsa-mir-411 hsa-mir-299 hsa-mir-380 hsa-mir-1197 hsa-mir-323a hsa-mir-758 hsa-mir-329-1 hsa-mir-329-2 hsa-mir-494 hsa-mir-1193 hsa-mir-543 hsa-mir-495 |
||||
| Family | mir-329 (MIPF0000110) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 3 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |