| Accession | MI0001648 | ||||
| Name | hsa-mir-449a | ||||
| similar to following miRCarta precursors | hsa-696.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr5:55,170,532-55,170,622 (-) |
||||
| miRNA | hsa-miR-449a | ||||
| Sequence (5' -> 3') (91 nts) |
CUGUGUGUGAUGAGCUGGCAGUGUAUUGUUAGCUGGUUGAAUAUGUGAAUGGCAUCGGCUAACAUGCAACUGCUGUCUUAUUGCAUAUACA | ||||
| MFE | -38.40 kcal/mol | ||||
| first miRBase version | 6.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-449a hsa-mir-449b hsa-mir-449c |
||||
| Family | mir-449 (MIPF0000133) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xie et al. | Nature | 2005 | 15735639 | Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |