Precursor miRBase

hsa-mir-425 (MI0001448)

Accession MI0001448
Name hsa-mir-425
similar to following miRCarta precursors hsa-95-258.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr3:49,020,148-49,020,234 (-)
miRNA hsa-miR-425-5p
miRNA hsa-miR-425-3p
Sequence (5' -> 3')
(87 nts)
GAAAGCGCUUUGGAAUGACACGAUCACUCCCGUUGAGUGGGCACCCGAGAAGCCAUCGGGAAUGUCGUGUCCGCCCAGUGCUCUUUC
MFE -34.50 kcal/mol
first miRBase version 5.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-425
hsa-mir-191
Family mir-425 (MIPF0000242)
Experiments
experiment Pubmed link
cloned 17604727 17616659 15891114
External DBs
Gene symbol MIR425
NCBI Gene 494337

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
2 Altuvia et al. Nucleic Acids Res. 2005 15891114 Clustering and conservation patterns of human microRNAs.
3 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.