Precursor miRBase

gga-mir-122-1 (MI0001277)

Accession MI0001277
Name gga-mir-122-1
similar to following miRCarta precursors gga-834-875.1
Organism Gallus gallus
Genome Gallus-gallus-4.0
Location chrZ:761,054-761,130 (+)
miRNA gga-miR-122-5p
miRNA gga-miR-122-3p
Sequence (5' -> 3')
(77 nts)
CAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCCAAUCUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGGUAG
MFE -36.80 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
gga-mir-122-1
Family mir-122 (MIPF0000095)
Experiments
experiment Pubmed link
Illumina 23034410

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Hillier et al. Nature 2004 15592404 Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.
2 Xu et al. FEBS Lett. 2006 16750530 Identification of microRNAs from different tissues of chicken embryo and adult chicken.
3 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.