| Accession | MI0001277 | ||||
| Name | gga-mir-122-1 | ||||
| similar to following miRCarta precursors | gga-834-875.1 | ||||
| Organism | Gallus gallus | ||||
| Genome | Gallus-gallus-4.0 | ||||
| Location |
chrZ:761,054-761,130 (+) |
||||
| miRNA | gga-miR-122-5p | ||||
| miRNA | gga-miR-122-3p | ||||
| Sequence (5' -> 3') (77 nts) |
CAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCCAAUCUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGGUAG | ||||
| MFE | -36.80 kcal/mol | ||||
| first miRBase version | 4.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
gga-mir-122-1 |
||||
| Family | mir-122 (MIPF0000095) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hillier et al. | Nature | 2004 | 15592404 | Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. |
| 2 | Xu et al. | FEBS Lett. | 2006 | 16750530 | Identification of microRNAs from different tissues of chicken embryo and adult chicken. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |