Precursor miRBase

gga-mir-140 (MI0001229)

Accession MI0001229
Name gga-mir-140
similar to following miRCarta precursors gga-26642-26641.1
Organism Gallus gallus
Genome Gallus-gallus-4.0
Location chr11:18,514,128-18,514,222 (+)
miRNA gga-miR-140-5p
miRNA gga-miR-140-3p
Sequence (5' -> 3')
(95 nts)
UGCGUCUCUCCGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACGGGAUGCCGGGGC
MFE -50.40 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
gga-mir-140
Family mir-140 (MIPF0000085)
Experiments
experiment Pubmed link
cloned 16750530
Northern blot 16750530

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Hillier et al. Nature 2004 15592404 Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.
2 Xu et al. FEBS Lett. 2006 16750530 Identification of microRNAs from different tissues of chicken embryo and adult chicken.
3 Yao et al. J. Virol. 2008 18256158 MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs.