| Accession | MI0001222 | ||||
| Name | gga-mir-16-2 | ||||
| similar to following miRCarta precursors | gga-26584-26583.1 | ||||
| Organism | Gallus gallus | ||||
| Genome | Gallus-gallus-4.0 | ||||
| Location |
chr9:21,653,410-21,653,503 (-) |
||||
| miRNA | gga-miR-16-5p | ||||
| miRNA | gga-miR-16-2-3p | ||||
| Sequence (5' -> 3') (94 nts) |
CCUACUUGUUCCGCCCUAGCAGCACGUAAAUAUUGGUGUAGUAAAAUAAACCUUAAACCCCAAUAUUAUUGUGCUGCUUAAGCGUGGCAGAGAU | ||||
| MFE | -29.60 kcal/mol | ||||
| first miRBase version | 4.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
gga-mir-16-2 gga-mir-15b |
||||
| Family | mir-15 (MIPF0000006) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hillier et al. | Nature | 2004 | 15592404 | Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. |
| 2 | Yao et al. | J. Virol. | 2008 | 18256158 | MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |