| Accession | MI0001220 | ||||||
| Name | gga-mir-199-2 | ||||||
| similar to following miRCarta precursors | gga-86-26034.1 | ||||||
| potential naming conflicts with | gga-mir-199-1 (MI0001245) | ||||||
| Organism | Gallus gallus | ||||||
| Genome | Gallus-gallus-4.0 | ||||||
| Location |
chr8:4,621,376-4,621,483 (+) |
||||||
| miRNA | gga-miR-199-5p | ||||||
| miRNA | gga-miR-199-3p | ||||||
| Sequence (5' -> 3') (108 nts) |
GAAGCGUCCGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCUGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAAAGCA | ||||||
| MFE | -42.00 kcal/mol | ||||||
| first miRBase version | 4.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
gga-mir-199-2 gga-mir-214 |
||||||
| Family | mir-199 (MIPF0000040) | ||||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hillier et al. | Nature | 2004 | 15592404 | Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. |
| 2 | Xu et al. | FEBS Lett. | 2006 | 16750530 | Identification of microRNAs from different tissues of chicken embryo and adult chicken. |