Accession | MI0001179 | ||||
Name | gga-mir-92-1 | ||||
similar to following miRCarta precursors | gga-26175-9.1 | ||||
Organism | Gallus gallus | ||||
Genome | Gallus-gallus-4.0 | ||||
Location |
chr1:147,253,128-147,253,205 (-) |
||||
miRNA | gga-miR-92-5p | ||||
miRNA | gga-miR-92-3p | ||||
Sequence (5' -> 3') (78 nts) |
CUUUCUACACAGGUUGGGAUCAGUUGCAAUGCUGUGCGUUUCUGUGGUAUUGCACUUGUCCCGGCCUGUUGAGGUUGG | ||||
MFE | -34.40 kcal/mol | ||||
first miRBase version | 4.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
gga-mir-92-1 gga-mir-19b gga-mir-20a gga-mir-19a gga-mir-18a gga-mir-17 |
||||
Family | mir-25 (MIPF0000013) | ||||
Experiments |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Hillier et al. | Nature | 2004 | 15592404 | Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. |
2 | Yao et al. | J. Virol. | 2008 | 18256158 | MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs. |
3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |