| Accession | MI0001177 | ||||
| Name | gga-mir-222a | ||||
| similar to following miRCarta precursors | gga-140.1 | ||||
| Organism | Gallus gallus | ||||
| Genome | Gallus-gallus-4.0 | ||||
| Location |
chr1:109,977,177-109,977,274 (+) |
||||
| miRNA | gga-miR-222a | ||||
| Sequence (5' -> 3') (98 nts) |
UGUAGUUGCCCAUCAAUCGCUCAGUAGUCAGUGUAGAUUCUGUCUUUACAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGACAUCUCAUAUCU | ||||
| MFE | -34.50 kcal/mol | ||||
| first miRBase version | 4.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
gga-mir-222a gga-mir-221 |
||||
| Family | mir-221 (MIPF0000051) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hillier et al. | Nature | 2004 | 15592404 | Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. |
| 2 | Yao et al. | J. Virol. | 2008 | 18256158 | MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs. |