Accession | MI0001172 |
Name | gga-let-7b |
similar to following miRCarta precursors | gga-26136.1 |
potential naming conflicts with | gga-let-7b (MIMAT0001102) |
Organism | Gallus gallus |
Genome | Gallus-gallus-4.0 |
Location |
chr1:71,371,979-71,372,063 (+) |
miRNA | gga-let-7b |
Sequence (5' -> 3') (85 nts) |
CAGGAUGAGGUAGUAGGUUGUGUGGUUUCAGGGUAGUGAUUUUGCCCCAAUCAGGAGAUAACUAUACAACCUACUGCCUUCCCUG |
MFE | -42.00 kcal/mol |
first miRBase version | 4.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
gga-let-7a-3
gga-let-7b |
Family | let-7 (MIPF0000002) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Hillier et al. | Nature | 2004 | 15592404 | Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. |