Accession | MI0001162 | ||||||
Name | mmu-mir-376b | ||||||
similar to following miRCarta precursors | mmu-25235-25234.1 | ||||||
Organism | Mus musculus | ||||||
Genome | GRCm38.p5 | ||||||
Location |
chr12:109,723,458-109,723,539 (+) |
||||||
miRNA | mmu-miR-376b-5p | ||||||
miRNA | mmu-miR-376b-3p | ||||||
Sequence (5' -> 3') (82 nts) |
UGGUAUUUAAAAGGUGGAUAUUCCUUCUAUGGUUACGUGCUUCCUGGAUAAUCAUAGAGGAACAUCCACUUUUUCAGUAUCA | ||||||
MFE | -32.80 kcal/mol | ||||||
first miRBase version | 5.0 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (17 precursors) |
mmu-mir-329
mmu-mir-494 mmu-mir-679 mmu-mir-1193 mmu-mir-666 mmu-mir-543 mmu-mir-495 mmu-mir-667 mmu-mir-376c mmu-mir-654 mmu-mir-376b mmu-mir-376a mmu-mir-300 mmu-mir-381 mmu-mir-487b mmu-mir-539 mmu-mir-544 |
||||||
Family | mir-368 (MIPF0000091) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Seitz et al. | Genome Res. | 2004 | 15310658 | A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. |
2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Kawahara et al. | Science | 2007 | 17322061 | Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. |
5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
6 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |