| Accession | MI0000974 | ||||
| Name | mmu-mir-215 | ||||
| similar to following miRCarta precursors | mmu-24216-24215.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr1:185,313,581-185,313,692 (+) |
||||
| miRNA | mmu-miR-215-5p | ||||
| miRNA | mmu-miR-215-3p | ||||
| Sequence (5' -> 3') (112 nts) |
AGCUCUCAGCAUCAACGGUGUACAGGAGAAUGACCUAUGAUUUGACAGACCGUGCAGCUGUGUAUGUCUGUCAUUCUGUAGGCCAAUAUUCUGUAUGUCACUGCUACUUAAA | ||||
| MFE | -36.70 kcal/mol | ||||
| first miRBase version | 3.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
mmu-mir-194-1
mmu-mir-215 |
||||
| Family | mir-192 (MIPF0000063) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 2 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 3 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |