| Accession | MI0000916 | ||||
| Name | rno-mir-143 | ||||
| similar to following miRCarta precursors | rno-211-3.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr18:56,200,186-56,200,290 (-) |
||||
| miRNA | rno-miR-143-5p | ||||
| miRNA | rno-miR-143-3p | ||||
| Sequence (5' -> 3') (105 nts) |
GCGGAGCGCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGGGAGAAGAUGUUCUGCAGC | ||||
| MFE | -63.50 kcal/mol | ||||
| first miRBase version | 3.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
rno-mir-145
rno-mir-143 |
||||
| Family | mir-143 (MIPF0000094) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 2 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |