| Accession | MI0000911 | ||||
| Name | rno-mir-138-2 | ||||
| similar to following miRCarta precursors | rno-509-1015.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr19:11,127,479-11,127,560 (-) |
||||
| miRNA | rno-miR-138-5p | ||||
| miRNA | rno-miR-138-2-3p | ||||
| Sequence (5' -> 3') (82 nts) |
GUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAACGCAUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCACC | ||||
| MFE | -32.70 kcal/mol | ||||
| first miRBase version | 3.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
rno-mir-138-2 |
||||
| Family | mir-138 (MIPF0000075) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Miska et al. | Genome Biol. | 2004 | 15345052 | Microarray analysis of microRNA expression in the developing mammalian brain. |
| 2 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | He et al. | Acta Biochim. Biophys. Sin. (Shanghai) | 2007 | 17805466 | Cloning and identification of novel microRNAs from rat hippocampus. |
| 5 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |