Precursor miRBase

rno-mir-124-1 (MI0000893)

Accession MI0000893
Name rno-mir-124-1
similar to following miRCarta precursors rno-946-837.2
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr15:51,712,751-51,712,835 (+)
miRNA rno-miR-124-5p
miRNA rno-miR-124-3p
Sequence (5' -> 3')
(85 nts)
AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG
MFE -35.30 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
rno-mir-124-1
Family mir-124 (MIPF0000021)
Experiments
experiment Pubmed link
cloned 17604727
SOLiD 20403161
External DBs
Gene symbol Mir124-1
NCBI Gene 100314291

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Miska et al. Genome Biol. 2004 15345052 Microarray analysis of microRNA expression in the developing mammalian brain.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.