Precursor miRBase

rno-mir-98 (MI0000882)

Accession MI0000882
Name rno-mir-98
similar to following miRCarta precursors rno-143-367.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chrX:21,867,881-21,867,988 (-)
miRNA rno-miR-98-5p
miRNA rno-miR-98-3p
Sequence (5' -> 3')
(108 nts)
CUGCACAUGCUGGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUUUUAGGCCCCAAUAAGAAGAUAACUAUACAACUUACUACUUUCCCUGGUGUGUGGCAU
MFE -51.70 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
rno-mir-98
rno-let-7f-2
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
SOLiD 20403161
External DBs
Gene symbol Mir98
NCBI Gene 100314018

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.