Precursor miRBase

rno-mir-30a (MI0000870)

Accession MI0000870
Name rno-mir-30a
similar to following miRCarta precursors rno-15-38.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr9:28,377,823-28,377,893 (+)
miRNA rno-miR-30a-5p
miRNA rno-miR-30a-3p
Sequence (5' -> 3')
(71 nts)
GCAACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAAAUGGGCUUUCAGUCGGAUGUUUGCAGCUGC
MFE -37.90 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
rno-mir-30a
Family mir-30 (MIPF0000005)
Experiments
experiment Pubmed link
cloned 17805466 17604727 16766679
SOLiD 20403161
External DBs
Gene symbol Mir30a
NCBI Gene 100314011

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
2 He et al. Acta Biochim. Biophys. Sin. (Shanghai) 2007 17805466 Cloning and identification of novel microRNAs from rat hippocampus.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.