Precursor miRBase

rno-mir-30d (MI0000869)

Accession MI0000869
Name rno-mir-30d
similar to following miRCarta precursors rno-25370-254.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr7:109,228,641-109,228,722 (-)
miRNA rno-miR-30d-5p
miRNA rno-miR-30d-3p
Sequence (5' -> 3')
(82 nts)
AAGUCUGUGUCUGUAAACAUCCCCGACUGGAAGCUGUAAGCCACAGCCAAGCUUUCAGUCAGAUGUUUGCUGCUACUGGCUC
MFE -33.80 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
rno-mir-30d
Family mir-30 (MIPF0000005)
Experiments
experiment Pubmed link
cloned 17604727
SOLiD 20403161
External DBs
Gene symbol Mir30d
NCBI Gene 100314010

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.