Accession | MI0000833 | ||||
Name | rno-let-7f-1 | ||||
similar to following miRCarta precursors | rno-20-275.1 | ||||
Organism | Rattus norvegicus | ||||
Genome | Rnor_5.0 | ||||
Location |
chr17:18,474,334-18,474,422 (+) |
||||
miRNA | rno-let-7f-5p | ||||
miRNA | rno-let-7f-1-3p | ||||
Sequence (5' -> 3') (89 nts) |
AUCAGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUUUUACCCUGUUUAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGAG | ||||
MFE | -41.50 kcal/mol | ||||
first miRBase version | 3.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (5 precursors) |
rno-let-7a-1
rno-mir-3596d rno-let-7f-1 rno-let-7d rno-mir-3596b |
||||
Family | let-7 (MIPF0000002) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | He et al. | Acta Biochim. Biophys. Sin. (Shanghai) | 2007 | 17805466 | Cloning and identification of novel microRNAs from rat hippocampus. |
5 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |