Accession | MI0000832 | ||||||
Name | rno-let-7e | ||||||
similar to following miRCarta precursors | rno-50-260.1 | ||||||
potential naming conflicts with | rno-let-7e-5p (MIMAT0000777) | ||||||
Organism | Rattus norvegicus | ||||||
Genome | Rnor_5.0 | ||||||
Location |
chr1:60,624,039-60,624,131 (+) |
||||||
miRNA | rno-let-7e-5p | ||||||
miRNA | rno-let-7e-3p | ||||||
Sequence (5' -> 3') (93 nts) |
CGCGCCCCCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAAGACACCCGAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGGCUGCGCC | ||||||
MFE | -45.30 kcal/mol | ||||||
first miRBase version | 3.1 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (4 precursors) |
rno-mir-99b
rno-mir-3596c rno-let-7e rno-mir-125a |
||||||
Family | let-7 (MIPF0000002) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |