Precursor miRBase

mmu-mir-335 (MI0000817)

Accession MI0000817
Name mmu-mir-335
similar to following miRCarta precursors mmu-249-24618.1
Organism Mus musculus
Genome GRCm38.p5
Location chr6:30,741,299-30,741,396 (+)
miRNA mmu-miR-335-5p
miRNA mmu-miR-335-3p
Sequence (5' -> 3')
(98 nts)
UCUUUUGGGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUUUUUCGUAAACCGUUUUUCAUUAUUGCUCCUGACCCCCUCUCAUGGGUUAUAGCCA
MFE -44.30 kcal/mol
first miRBase version 3.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-335
Family mir-335 (MIPF0000196)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727
External DBs
Gene symbol Mir335
NCBI Gene 723930

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Sathyan et al. J. Neurosci. 2007 17687032 Competing interactions between micro-RNAs determine neural progenitor survival and proliferation after ethanol exposure: evidence from an ex vivo model of the fetal cerebral cortical neuroepithelium.
5 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
6 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.