| Accession | MI0000767 | ||||
| Name | hsa-mir-365a | ||||
| similar to following miRCarta precursors | hsa-595-176.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr16:14,309,285-14,309,371 (+) |
||||
| miRNA | hsa-miR-365a-5p | ||||
| miRNA | hsa-miR-365a-3p | ||||
| Sequence (5' -> 3') (87 nts) |
ACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCA | ||||
| MFE | -34.50 kcal/mol | ||||
| first miRBase version | 6.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-193b
hsa-mir-365a |
||||
| Family | mir-365 (MIPF0000061) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xie et al. | Nature | 2005 | 15735639 | Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. |
| 2 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |