Accession | MI0000762 | ||||
Name | hsa-mir-362 | ||||
similar to following miRCarta precursors | hsa-267-428.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chrX:50,008,964-50,009,028 (+) |
||||
miRNA | hsa-miR-362-5p | ||||
miRNA | hsa-miR-362-3p | ||||
Sequence (5' -> 3') (65 nts) |
CUUGAAUCCUUGGAACCUAGGUGUGAGUGCUAUUUCAGUGCAACACACCUAUUCAAGGAUUCAAA | ||||
MFE | -31.50 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (8 precursors) |
hsa-mir-532
hsa-mir-188 hsa-mir-500a hsa-mir-362 hsa-mir-501 hsa-mir-500b hsa-mir-660 hsa-mir-502 |
||||
Family | mir-362 (MIPF0000209) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
2 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |