Precursor miRBase

hsa-mir-30c-1 (MI0000736)

Accession MI0000736
Name hsa-mir-30c-1
similar to following miRCarta precursors hsa-57-456.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr1:40,757,284-40,757,372 (+)
miRNA hsa-miR-30c-5p
miRNA hsa-miR-30c-1-3p
Sequence (5' -> 3')
(89 nts)
ACCAUGCUGUAGUGUGUGUAAACAUCCUACACUCUCAGCUGUGAGCUCAAGGUGGCUGGGAGAGGGUUGUUUACUCCUUCUGCCAUGGA
MFE -34.30 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-30e
hsa-mir-30c-1
Family mir-30 (MIPF0000005)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR30C1
NCBI Gene 407031

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
3 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
4 Fu et al. FEBS Lett. 2005 15978578 Identification of human fetal liver miRNAs by a novel method.
5 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
6 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.