| Accession | MI0000724 | ||||||
| Name | mmu-mir-181c | ||||||
| similar to following miRCarta precursors | mmu-165-24845.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr8:84,178,873-84,178,961 (-) |
||||||
| miRNA | mmu-miR-181c-5p | ||||||
| miRNA | mmu-miR-181c-3p | ||||||
| Sequence (5' -> 3') (89 nts) |
GCCAAGGGUUUGGGGGAACAUUCAACCUGUCGGUGAGUUUGGGCAGCUCAGACAAACCAUCGACCGUUGAGUGGACCCCGAGGCCUGGA | ||||||
| MFE | -45.60 kcal/mol | ||||||
| first miRBase version | 3.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
mmu-mir-181d
mmu-mir-181c |
||||||
| Family | mir-181 (MIPF0000007) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 6 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |