| Accession | MI0000702 | ||||
| Name | mmu-mir-219a-1 | ||||
| similar to following miRCarta precursors | mmu-569-25496.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr17:34,024,983-34,025,092 (-) |
||||
| miRNA | mmu-miR-219a-5p | ||||
| miRNA | mmu-miR-219a-1-3p | ||||
| Sequence (5' -> 3') (110 nts) |
CCGUCCCGGGCCGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGAGUCUCUGGCUCCGGCCGAGAGUUGCGUCUGGACGUCCCGAGCCGCCGCCCCCAAACCUCGAGGGGG | ||||
| MFE | -58.70 kcal/mol | ||||
| first miRBase version | 3.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
mmu-mir-219a-1 mmu-mir-219c |
||||
| Family | mir-219 (MIPF0000044) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 2 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |