Accession | MI0000699 | ||||
Name | mmu-mir-216a | ||||
similar to following miRCarta precursors | mmu-778-957.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr11:28,757,012-28,757,083 (+) |
||||
miRNA | mmu-miR-216a-5p | ||||
miRNA | mmu-miR-216a-3p | ||||
Sequence (5' -> 3') (72 nts) |
UUGGUUUAAUCUCAGCUGGCAACUGUGAGAUGUCCCUAUCAUUCCUCACAGUGGUCUCUGGGAUUAUGCUAA | ||||
MFE | -30.00 kcal/mol | ||||
first miRBase version | 3.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
mmu-mir-216a mmu-mir-217 |
||||
Family | mir-216 (MIPF0000054) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
2 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |