Precursor miRBase

mmu-mir-32 (MI0000691)

Accession MI0000691
Name mmu-mir-32
similar to following miRCarta precursors mmu-208-518.1
Organism Mus musculus
Genome GRCm38.p5
Location chr4:56,895,229-56,895,298 (-)
miRNA mmu-miR-32-5p
miRNA mmu-miR-32-3p
Sequence (5' -> 3')
(70 nts)
GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC
MFE -30.00 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-32
Family mir-32 (MIPF0000069)
Experiments
experiment Pubmed link
Illumina 20413612
454 20668074
External DBs
Gene symbol Mir32
NCBI Gene 723837

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
3 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Zhu et al. J. Virol. 2010 20668074 Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68.
6 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
7 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.