| Accession | MI0000687 | ||||||
| Name | mmu-mir-17 | ||||||
| similar to following miRCarta precursors | mmu-88-25348.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr14:115,043,671-115,043,754 (+) |
||||||
| miRNA | mmu-miR-17-5p | ||||||
| miRNA | mmu-miR-17-3p | ||||||
| Sequence (5' -> 3') (84 nts) |
GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUGUGUGCAUCUACUGCAGUGAGGGCACUUGUAGCAUUAUGCUGAC | ||||||
| MFE | -36.70 kcal/mol | ||||||
| first miRBase version | 3.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (6 precursors) |
mmu-mir-17 mmu-mir-18a mmu-mir-19a mmu-mir-20a mmu-mir-19b-1 mmu-mir-92a-1 |
||||||
| Family | mir-17 (MIPF0000001) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Science | 2001 | 11679670 | Identification of novel genes coding for small expressed RNAs. |
| 2 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
| 3 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 4 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 6 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 7 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |