| Accession | MI0000681 | ||||
| Name | hsa-mir-155 | ||||
| similar to following miRCarta precursors | hsa-109-1045.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr21:25,573,980-25,574,044 (+) |
||||
| miRNA | hsa-miR-155-5p | ||||
| miRNA | hsa-miR-155-3p | ||||
| Sequence (5' -> 3') (65 nts) |
CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUUAACAG | ||||
| MFE | -29.50 kcal/mol | ||||
| first miRBase version | 3.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-155 |
||||
| Family | mir-155 (MIPF0000157) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 3 | Eis et al. | Proc. Natl. Acad. Sci. U.S.A. | 2005 | 15738415 | Accumulation of miR-155 and BIC RNA in human B cell lymphomas. |
| 4 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 5 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 6 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 7 | Marton et al. | Leukemia | 2008 | 17989717 | Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis. |