| Accession | MI0000651 | ||||
| Name | hsa-mir-1-1 | ||||
| similar to following miRCarta precursors | hsa-1151-310.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr20:62,554,306-62,554,376 (+) |
||||
| miRNA | hsa-miR-1-5p | ||||
| miRNA | hsa-miR-1-3p | ||||
| Sequence (5' -> 3') (71 nts) |
UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA | ||||
| MFE | -29.10 kcal/mol | ||||
| first miRBase version | 2.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-1-1 |
||||
| Family | mir-1 (MIPF0000038) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Koh et al. | BMC Genomics | 2010 | 20158877 | Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha. |