Precursor miRBase

rno-let-7d (MI0000601)

Accession MI0000601
Name rno-let-7d
similar to following miRCarta precursors rno-90-98.1
potential naming conflicts with rno-let-7d-5p (MIMAT0000562)
Organism Rattus norvegicus
Genome Rnor_5.0
Location chr17:18,476,093-18,476,190 (+)
miRNA rno-let-7d-5p
miRNA rno-let-7d-3p
Sequence (5' -> 3')
(98 nts)
UGGGCUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGAGAUUUUGCCCACAAGGAGUUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUU
MFE -51.60 kcal/mol
first miRBase version 3.0
last miRBase version 21.0
Clusters (10 kb)
(5 precursors)
rno-let-7a-1
rno-mir-3596d
rno-let-7f-1
rno-let-7d
rno-mir-3596b
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
cloned 17604727 14691248
Northern blot 14691248
SOLiD 20403161
External DBs
Gene symbol Mirlet7d
NCBI Gene 100313972

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Miska et al. Genome Biol. 2004 15345052 Microarray analysis of microRNA expression in the developing mammalian brain.
2 Kim et al. Proc. Natl. Acad. Sci. U.S.A. 2004 14691248 Identification of many microRNAs that copurify with polyribosomes in mammalian neurons.
3 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.