| Accession | MI0000590 | ||||||
| Name | mmu-mir-322 | ||||||
| similar to following miRCarta precursors | mmu-25656-25655.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chrX:53,054,255-53,054,349 (-) |
||||||
| miRNA | mmu-miR-322-5p | ||||||
| miRNA | mmu-miR-322-3p | ||||||
| Sequence (5' -> 3') (95 nts) |
CCUCGUUGACUCCGAAGGGCUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGGAA | ||||||
| MFE | -41.60 kcal/mol | ||||||
| first miRBase version | 3.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (7 precursors) |
mmu-mir-450b
mmu-mir-450a-1 mmu-mir-450a-2 mmu-mir-542 mmu-mir-351 mmu-mir-503 mmu-mir-322 |
||||||
| Family | mir-322 (MIPF0000164) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kim et al. | Proc. Natl. Acad. Sci. U.S.A. | 2004 | 14691248 | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. |
| 2 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 3 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 6 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |