Precursor miRBase

mmu-mir-96 (MI0000583)

Accession MI0000583
Name mmu-mir-96
similar to following miRCarta precursors mmu-248-24615.1
Organism Mus musculus
Genome GRCm38.p5
Location chr6:30,169,446-30,169,551 (-)
miRNA mmu-miR-96-5p
miRNA mmu-miR-96-3p
Sequence (5' -> 3')
(106 nts)
CCAGUACCAUCUGCUUGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUGUGAGCAAUCAUGUGUAGUGCCAAUAUGGGAAAAGCGGGCUGCUGC
MFE -47.90 kcal/mol
first miRBase version 2.1
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
mmu-mir-182
mmu-mir-96
mmu-mir-183
Family mir-96 (MIPF0000072)
Experiments
experiment Pubmed link
Illumina 20413612
454 20668074
External DBs
Gene symbol Mir96
NCBI Gene 723886

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
2 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.
5 Zhu et al. J. Virol. 2010 20668074 Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68.
6 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.