Precursor miRBase

mmu-mir-16-1 (MI0000565)

Accession MI0000565
Name mmu-mir-16-1
similar to following miRCarta precursors mmu-62-25333.1
Organism Mus musculus
Genome GRCm38.p5
Location chr14:61,631,880-61,631,972 (-)
miRNA mmu-miR-16-5p
miRNA mmu-miR-16-1-3p
Sequence (5' -> 3')
(93 nts)
AUGUCAGCGGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUGAAAUUACCUCCAGUAUUGACUGUGCUGCUGAAGUAAGGUUGGCAA
MFE -36.20 kcal/mol
first miRBase version 2.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
mmu-mir-16-1
mmu-mir-15a
Family mir-15 (MIPF0000006)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727
External DBs
Gene symbol Mir16-1
NCBI Gene 387134

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
3 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
4 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
5 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
6 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
7 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.