| Accession | MI0000465 | ||||
| Name | hsa-mir-191 | ||||
| similar to following miRCarta precursors | hsa-48-413.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr3:49,020,618-49,020,709 (-) |
||||
| miRNA | hsa-miR-191-5p | ||||
| miRNA | hsa-miR-191-3p | ||||
| Sequence (5' -> 3') (92 nts) |
CGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCGCUUGGAUUUCGUCCCCUGCUCUCCUGCCU | ||||
| MFE | -46.80 kcal/mol | ||||
| first miRBase version | 2.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-425
hsa-mir-191 |
||||
| Family | mir-191 (MIPF0000194) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
| 2 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 3 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |