| Accession | MI0000450 | ||||
| Name | hsa-mir-133a-1 | ||||
| similar to following miRCarta precursors | hsa-902-320.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr18:21,825,698-21,825,785 (-) |
||||
| miRNA | hsa-miR-133a-5p | ||||
| miRNA | hsa-miR-133a-3p | ||||
| Sequence (5' -> 3') (88 nts) |
ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA | ||||
| MFE | -40.70 kcal/mol | ||||
| first miRBase version | 2.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-133a-1 hsa-mir-1-2 |
||||
| Family | mir-133 (MIPF0000029) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |