| Accession | MI0000444 | ||||
| Name | hsa-mir-124-2 | ||||
| similar to following miRCarta precursors | hsa-946-837.2 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr8:64,379,149-64,379,257 (+) |
||||
| miRNA | hsa-miR-124-5p | ||||
| miRNA | hsa-miR-124-3p | ||||
| Sequence (5' -> 3') (109 nts) |
AUCAAGAUUAGAGGCUCUGCUCUCCGUGUUCACAGCGGACCUUGAUUUAAUGUCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGCGGAGCCUACGGCUGCACUUGAA | ||||
| MFE | -50.80 kcal/mol | ||||
| first miRBase version | 2.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-124-2 |
||||
| Family | mir-124 (MIPF0000021) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 3 | Suh et al. | Dev. Biol. | 2004 | 15183728 | Human embryonic stem cells express a unique set of microRNAs. |
| 4 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |